<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Marko</id>
		<title>Ucsbgalaxy - User contributions [en]</title>
		<link rel="self" type="application/atom+xml" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Marko"/>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php/Special:Contributions/Marko"/>
		<updated>2026-05-09T16:39:11Z</updated>
		<subtitle>User contributions</subtitle>
		<generator>MediaWiki 1.28.2</generator>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Galaxy_illumina_Data_Processing&amp;diff=721</id>
		<title>Galaxy illumina Data Processing</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Galaxy_illumina_Data_Processing&amp;diff=721"/>
				<updated>2011-12-02T01:43:23Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;*[[Step 1 - Separating Multiplexed files into Libraries]]&lt;br /&gt;
*[[Step 2 - Filter Data and Assemble]]&lt;br /&gt;
*[[Step 3 - EvolMap]]&lt;br /&gt;
*[[Step 4 - HMMs]]&lt;br /&gt;
*[[Step 5 - Multiple Sequence Alignment]]&lt;br /&gt;
*[[Step 6 - Phylogenomics]]&lt;br /&gt;
&lt;br /&gt;
[http://knot.cnsi.ucsb.edu:8080/workflow/list_published All published workflows]&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Using_UCSB_Galaxy&amp;diff=714</id>
		<title>Using UCSB Galaxy</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Using_UCSB_Galaxy&amp;diff=714"/>
				<updated>2011-12-02T00:08:54Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;* [[The very basics]]&lt;br /&gt;
* [[Uploading data]]&lt;br /&gt;
* [[Restarting Galaxy]]&lt;br /&gt;
* [[Using Trinity Assembler]]&lt;br /&gt;
* [[Adding a tool from tool shed]]&lt;br /&gt;
* [[Creating a Workflow]]&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_2_-_Filter_Data_and_Assemble&amp;diff=713</id>
		<title>Step 2 - Filter Data and Assemble</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_2_-_Filter_Data_and_Assemble&amp;diff=713"/>
				<updated>2011-12-02T00:04:27Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;[http://knot.cnsi.ucsb.edu:8080/u/marko/w/trimremovefilterqc Trinity Workflow]&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Galaxy_illumina_Data_Processing&amp;diff=712</id>
		<title>Galaxy illumina Data Processing</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Galaxy_illumina_Data_Processing&amp;diff=712"/>
				<updated>2011-12-02T00:04:07Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;*[[Step 1 - Separating Multiplexed files into Libraries]]&lt;br /&gt;
*[[Step 2 - Filter Data and Assemble]]&lt;br /&gt;
*[[Step 3 - EvolMap]]&lt;br /&gt;
*[[Step 4 - HMMs]]&lt;br /&gt;
*[[Step 5 - Multiple Sequence Alignment]]&lt;br /&gt;
*[[Step 6 - Phylogenomics]]&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Galaxy_illumina_Data_Processing&amp;diff=711</id>
		<title>Galaxy illumina Data Processing</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Galaxy_illumina_Data_Processing&amp;diff=711"/>
				<updated>2011-12-02T00:03:51Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;*[[Step 1 - Separating Multiplexed files into Libraries]]&lt;br /&gt;
*[[Step 2 - Filter Data and Assemble]]&lt;br /&gt;
*[[Step 3 - EvolMap]]&lt;br /&gt;
*[[Step 4 - HMMs]&lt;br /&gt;
*[[Step 5 - Multiple Sequence Alignment]&lt;br /&gt;
*[[Step 6 - Phylogenomics]&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_2_-_Filter_Data_and_Assemble&amp;diff=710</id>
		<title>Step 2 - Filter Data and Assemble</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_2_-_Filter_Data_and_Assemble&amp;diff=710"/>
				<updated>2011-12-02T00:00:49Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;[http://knot.cnsi.ucsb.edu:8080/u/marko/w/trimremovefilterqc Workflow]&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_2_-_Filter_Data_and_Assemble&amp;diff=709</id>
		<title>Step 2 - Filter Data and Assemble</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_2_-_Filter_Data_and_Assemble&amp;diff=709"/>
				<updated>2011-12-02T00:00:33Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: Created page with &amp;quot;Workflow: [http://knot.cnsi.ucsb.edu:8080/u/marko/w/trimremovefilterqc]&amp;quot;&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Workflow: [http://knot.cnsi.ucsb.edu:8080/u/marko/w/trimremovefilterqc]&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Galaxy_illumina_Data_Processing&amp;diff=708</id>
		<title>Galaxy illumina Data Processing</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Galaxy_illumina_Data_Processing&amp;diff=708"/>
				<updated>2011-12-02T00:00:11Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;*[[Step 1 - Separating Multiplexed files into Libraries]]&lt;br /&gt;
*[[Step 2 - Filter Data and Assemble]]&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Galaxy_Development_Priorities&amp;diff=674</id>
		<title>Galaxy Development Priorities</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Galaxy_Development_Priorities&amp;diff=674"/>
				<updated>2011-12-01T17:05:25Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Roger&amp;#039;s Current Tasks==&lt;br /&gt;
*[[Evolmap output]]&lt;br /&gt;
*[[Implement EvolMap -- Assigned to Roger]]&lt;br /&gt;
&lt;br /&gt;
==Karl&amp;#039;s Current Tasks==&lt;br /&gt;
*[[Add proxy on macroevolution]]&lt;br /&gt;
*[[monit]]&lt;br /&gt;
*[[chron]]&lt;br /&gt;
&lt;br /&gt;
==To Add==&lt;br /&gt;
*[[Multiple instances]]&lt;br /&gt;
*[[Implement Hammstr - an external pipeline of tools]]&lt;br /&gt;
*[[Implement TransAbyss pipeline]]&lt;br /&gt;
*[[Implement Davis&amp;#039; Illumina Scripts]]&lt;br /&gt;
*[[Implement RAxML]]&lt;br /&gt;
*[[Implement r8s]]&lt;br /&gt;
*[[Implement sequence alignment tools, MUSCLE MAFFT PROALIGN]]&lt;br /&gt;
*[[Implement phylogenetics scripts like format converters and concatenation tools]]&lt;br /&gt;
*[[Implement NCBI&amp;#039;s tools from SRA Toolkit]]&lt;br /&gt;
&lt;br /&gt;
==Added==&lt;br /&gt;
*[[Recently enabled tools]]&lt;br /&gt;
*[[Regular Expression Search and replace  -- Assigned to Karl]]&lt;br /&gt;
*[[Beast]]&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Galaxy_Development_Priorities&amp;diff=673</id>
		<title>Galaxy Development Priorities</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Galaxy_Development_Priorities&amp;diff=673"/>
				<updated>2011-12-01T17:04:22Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Roger&amp;#039;s Current Tasks==&lt;br /&gt;
*[[Evolmap output]]&lt;br /&gt;
*[[Implement EvolMap -- Assigned to Roger]]&lt;br /&gt;
&lt;br /&gt;
==Karl&amp;#039;s Current Tasks==&lt;br /&gt;
*[[Add proxy on macroevolution]]&lt;br /&gt;
*[[monit]]&lt;br /&gt;
&lt;br /&gt;
==To Add==&lt;br /&gt;
*[[Multiple instances]]&lt;br /&gt;
*[[Implement Hammstr - an external pipeline of tools]]&lt;br /&gt;
*[[Implement TransAbyss pipeline]]&lt;br /&gt;
*[[Implement Davis&amp;#039; Illumina Scripts]]&lt;br /&gt;
*[[Implement RAxML]]&lt;br /&gt;
*[[Implement r8s]]&lt;br /&gt;
*[[Implement sequence alignment tools, MUSCLE MAFFT PROALIGN]]&lt;br /&gt;
*[[Implement phylogenetics scripts like format converters and concatenation tools]]&lt;br /&gt;
*[[Implement NCBI&amp;#039;s tools from SRA Toolkit]]&lt;br /&gt;
&lt;br /&gt;
==Added==&lt;br /&gt;
*[[Recently enabled tools]]&lt;br /&gt;
*[[Regular Expression Search and replace  -- Assigned to Karl]]&lt;br /&gt;
*[[Beast]]&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Galaxy_Development_Priorities&amp;diff=672</id>
		<title>Galaxy Development Priorities</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Galaxy_Development_Priorities&amp;diff=672"/>
				<updated>2011-12-01T17:03:41Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Roger&amp;#039;s Current Tasks==&lt;br /&gt;
*[[Evolmap output]]&lt;br /&gt;
*[[Implement EvolMap -- Assigned to Roger]]&lt;br /&gt;
&lt;br /&gt;
==Karl&amp;#039;s Current Tasks==&lt;br /&gt;
*[[Add proxy on macroevolution]]&lt;br /&gt;
*[[monit]]&lt;br /&gt;
*[[Debug search and replace]]&lt;br /&gt;
&lt;br /&gt;
==To Add==&lt;br /&gt;
*[[Multiple instances]]&lt;br /&gt;
*[[Implement Hammstr - an external pipeline of tools]]&lt;br /&gt;
*[[Implement TransAbyss pipeline]]&lt;br /&gt;
*[[Implement Davis&amp;#039; Illumina Scripts]]&lt;br /&gt;
*[[Implement RAxML]]&lt;br /&gt;
*[[Implement r8s]]&lt;br /&gt;
*[[Implement sequence alignment tools, MUSCLE MAFFT PROALIGN]]&lt;br /&gt;
*[[Implement phylogenetics scripts like format converters and concatenation tools]]&lt;br /&gt;
*[[Implement NCBI&amp;#039;s tools from SRA Toolkit]]&lt;br /&gt;
&lt;br /&gt;
==Added==&lt;br /&gt;
*[[Recently enabled tools]]&lt;br /&gt;
*[[Regular Expression Search and replace  -- Assigned to Karl]]&lt;br /&gt;
*[[Beast]]&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=669</id>
		<title>Step 1 - Separating Multiplexed files into Libraries</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=669"/>
				<updated>2011-12-01T01:32:13Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Barcode Splitting Workflow Introduction==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
The workflow can be found at the following link: [http://knot.cnsi.ucsb.edu:8080/u/marko/w/barcodesplitter]&lt;br /&gt;
&lt;br /&gt;
After clicking on the link, you can import the workflow into your own galaxy account in order to use it and/or edit it as required.&lt;br /&gt;
&lt;br /&gt;
The output from the illumina sequencing center at UC Davis produces two multiplexed Fastq format files (among thousands of others). &lt;br /&gt;
&lt;br /&gt;
These two files result from the paired-end sequencing run and are named S_6_1 (Left-hand reads) and S_6_3 (right hand reads) and contain all the data from all the species/samples that have have been pooled (multiplexed) into one lane. &lt;br /&gt;
&lt;br /&gt;
They will form the input for our workflow. &lt;br /&gt;
&lt;br /&gt;
The read containing /1 will be used as the left-hand read and the read containing /2 will be used as the right-hand read (see example below).&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Fastq Sanger format Left-hand Read:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
@HWI-EAS91_1_30788AAXX:7:21:1542:1758/1&lt;br /&gt;
&lt;br /&gt;
GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC&lt;br /&gt;
&lt;br /&gt;
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/1&lt;br /&gt;
&lt;br /&gt;
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Fastq Sanger format Right-hand Read:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
@HWI-EAS91_1_30788AAXX:7:21:1542:1758/2&lt;br /&gt;
&lt;br /&gt;
GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA&lt;br /&gt;
&lt;br /&gt;
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/2&lt;br /&gt;
&lt;br /&gt;
hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Currently, our output from UC Davis for right hand reads contains a /3 instead of the standard /2, so you will have to do a simple search and replace to correct this. More on this below.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Step by Step==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Prior to beginning the workflow in Galaxy, you need to upload the paired-end fastq files to a history in Galaxy by using the Upload File tool under the Get Data tab. This process will take a while, but can be accelerated if the files are placed in a folder on the macroevolution server [http://macroevolution.lifesci.ucsb.edu/IlluminaData/]&lt;br /&gt;
&lt;br /&gt;
You also have to upload a text file with the names of the respective libraries and the adapter sequences that identify them.&lt;br /&gt;
&lt;br /&gt;
Example:&lt;br /&gt;
&lt;br /&gt;
Dicy	 GAGCAAT&lt;br /&gt;
&lt;br /&gt;
ScA1	 TTGCGAT&lt;br /&gt;
&lt;br /&gt;
LrA3	 ACTAGCT&lt;br /&gt;
&lt;br /&gt;
MA1	 TGCAACT&lt;br /&gt;
&lt;br /&gt;
MA3	 GCATAGT&lt;br /&gt;
&lt;br /&gt;
MA4	 CATTCGT&lt;br /&gt;
&lt;br /&gt;
MA5	 ATGGCTT&lt;br /&gt;
&lt;br /&gt;
In order to run a workflow, you got to a history with the data you would like to process, then click on the workflow tab. This will take you to a list of all your workflows, click on the one you want and select run. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;#039;&amp;#039;&amp;#039;Steps 1 &amp;amp; 2&amp;#039;&amp;#039;&amp;#039;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
The first steps to any workflow involves single or multiple input datasets.&lt;br /&gt;
&lt;br /&gt;
For barcode splitting, we start with two input datasets, Step1 Input dataset for the left-hand fastq file and Step 2 input dataset for the right-hand fastq file.&lt;br /&gt;
&lt;br /&gt;
The right-hand fastq file needs to be corrected from /3 to /2. This will occur automatically with the Find and Replace tool.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;#039;&amp;#039;&amp;#039;Steps 3 &amp;amp; 4&amp;#039;&amp;#039;&amp;#039;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Here you need to select the text file with the adapter sequences. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;#039;&amp;#039;&amp;#039;Steps 5 &amp;amp; 6&amp;#039;&amp;#039;&amp;#039;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Here Fastq groomer will change the file formats to fastqsanger using Illumina 1.3+ quality scores type.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;#039;&amp;#039;&amp;#039;Step 7&amp;#039;&amp;#039;&amp;#039;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
The final step of this workflow splits the multiplexed Illumina file into multiple different files using the adapter sequences (barcode). For each barcode, a new fastq file is created. The output is an html table displaying the split counts and file locations. These can be downloaded or the link can be used to upload them into Galaxy.&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=668</id>
		<title>Step 1 - Separating Multiplexed files into Libraries</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=668"/>
				<updated>2011-12-01T01:30:56Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Barcode Splitting Workflow Introduction==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
The workflow can be found at the following link: [http://knot.cnsi.ucsb.edu:8080/u/marko/w/barcodesplitter]&lt;br /&gt;
&lt;br /&gt;
After clicking on the link, you can import the workflow into your own galaxy account in order to use it and/or edit it as required.&lt;br /&gt;
&lt;br /&gt;
The output from the illumina sequencing center at UC Davis produces two multiplexed Fastq format files (among thousands of others). &lt;br /&gt;
&lt;br /&gt;
These two files result from the paired-end sequencing run and are named S_6_1 (Left-hand reads) and S_6_3 (right hand reads) and contain all the data from all the species/samples that have have been pooled (multiplexed) into one lane. &lt;br /&gt;
&lt;br /&gt;
They will form the input for our workflow. &lt;br /&gt;
&lt;br /&gt;
The read containing /1 will be used as the left-hand read and the read containing /2 will be used as the right-hand read (see example below).&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Fastq Sanger format Left-hand Read:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
@HWI-EAS91_1_30788AAXX:7:21:1542:1758/1&lt;br /&gt;
&lt;br /&gt;
GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC&lt;br /&gt;
&lt;br /&gt;
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/1&lt;br /&gt;
&lt;br /&gt;
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Fastq Sanger format Right-hand Read:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
@HWI-EAS91_1_30788AAXX:7:21:1542:1758/2&lt;br /&gt;
&lt;br /&gt;
GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA&lt;br /&gt;
&lt;br /&gt;
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/2&lt;br /&gt;
&lt;br /&gt;
hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Currently, our output from UC Davis for right hand reads contains a /3 instead of the standard /2, so you will have to do a simple search and replace to correct this. More on this below.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Step by Step==&lt;br /&gt;
&lt;br /&gt;
Prior to beginning the workflow in Galaxy, you need to upload the paired-end fastq files to a history in Galaxy by using the Upload File tool under the Get Data tab. This process will take a while, but can be accelerated if the files are placed in a folder on the macroevolution server [http://macroevolution.lifesci.ucsb.edu/IlluminaData/]&lt;br /&gt;
&lt;br /&gt;
You also have to upload a text file with the names of the respective libraries and the adapter sequences that identify them.&lt;br /&gt;
&lt;br /&gt;
Example:&lt;br /&gt;
&lt;br /&gt;
Dicy	GAGCAAT&lt;br /&gt;
&lt;br /&gt;
ScA1	TTGCGAT&lt;br /&gt;
&lt;br /&gt;
LrA3	ACTAGCT&lt;br /&gt;
&lt;br /&gt;
MA1	TGCAACT&lt;br /&gt;
&lt;br /&gt;
MA3	GCATAGT&lt;br /&gt;
&lt;br /&gt;
MA4	CATTCGT&lt;br /&gt;
&lt;br /&gt;
MA5	ATGGCTT&lt;br /&gt;
&lt;br /&gt;
In order to run a workflow, you got to a history with the data you would like to process, then click on the workflow tab. This will take you to a list of all your workflows, click on the one you want and select run. &lt;br /&gt;
&lt;br /&gt;
&amp;#039;&amp;#039;&amp;#039;Steps 1 &amp;amp; 2&amp;#039;&amp;#039;&amp;#039;&lt;br /&gt;
&lt;br /&gt;
The first steps to any workflow involves single or multiple input datasets.&lt;br /&gt;
&lt;br /&gt;
For barcode splitting, we start with two input datasets, Step1 Input dataset for the left-hand fastq file and Step 2 input dataset for the right-hand fastq file.&lt;br /&gt;
&lt;br /&gt;
The right-hand fastq file needs to be corrected from /3 to /2. This will occur automatically with the Find and Replace tool.&lt;br /&gt;
&lt;br /&gt;
&amp;#039;&amp;#039;&amp;#039;Steps 3 &amp;amp; 4&amp;#039;&amp;#039;&amp;#039;&lt;br /&gt;
&lt;br /&gt;
Here you need to select the text file with the adapter sequences. &lt;br /&gt;
&lt;br /&gt;
&amp;#039;&amp;#039;&amp;#039;Steps 5 &amp;amp; 6&amp;#039;&amp;#039;&amp;#039;&lt;br /&gt;
&lt;br /&gt;
Here Fastq groomer will change the file formats to fastqsanger using Illumina 1.3+ quality scores type.&lt;br /&gt;
&lt;br /&gt;
&amp;#039;&amp;#039;&amp;#039;Step 7&amp;#039;&amp;#039;&amp;#039;&lt;br /&gt;
&lt;br /&gt;
The final step of this workflow splits the multiplexed Illumina file into multiple different files using the adapter sequences (barcode). For each barcode, a new fastq file is created. The output is an html table displaying the split counts and file locations. These can be downloaded or the link can be used to upload them into Galaxy.&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=667</id>
		<title>Step 1 - Separating Multiplexed files into Libraries</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=667"/>
				<updated>2011-12-01T01:11:33Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Barcode Splitting Workflow Introduction==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
The workflow can be found at the following link: [http://knot.cnsi.ucsb.edu:8080/u/marko/w/barcodesplitter]&lt;br /&gt;
&lt;br /&gt;
The output from the illumina sequencing center at UC Davis produces two multiplexed Fastq format files (among thousands of others). &lt;br /&gt;
&lt;br /&gt;
These two files result from the paired-end sequencing run and are named S_6_1 (Left-hand reads) and S_6_3 (right hand reads) and contain all the data from all the species/samples that have have been pooled (multiplexed) into one lane. &lt;br /&gt;
&lt;br /&gt;
They will form the input for our workflow. &lt;br /&gt;
&lt;br /&gt;
The read containing /1 will be used as the left-hand read and the read containing /2 will be used as the right-hand read (see example below).&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Fastq Sanger format Left-hand Read:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
@HWI-EAS91_1_30788AAXX:7:21:1542:1758/1&lt;br /&gt;
&lt;br /&gt;
GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC&lt;br /&gt;
&lt;br /&gt;
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/1&lt;br /&gt;
&lt;br /&gt;
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Fastq Sanger format Right-hand Read:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
@HWI-EAS91_1_30788AAXX:7:21:1542:1758/2&lt;br /&gt;
&lt;br /&gt;
GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA&lt;br /&gt;
&lt;br /&gt;
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/2&lt;br /&gt;
&lt;br /&gt;
hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Currently, our output from UC Davis for right hand reads contains a /3 instead of the standard /2, so we will do a simple search and replace to correct this. More on this below.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Step by Step==&lt;br /&gt;
&lt;br /&gt;
Prior to beginning the workflow in Galaxy, we need to upload the paired-end fastq files to a history in Galaxy by using the Upload File tool under the Get Data tab. This process will take a while, but can be accelerated if the files are placed in a folder on the macroevolution server [http://macroevolution.lifesci.ucsb.edu/IlluminaData/]&lt;br /&gt;
&lt;br /&gt;
&amp;#039;&amp;#039;&amp;#039;Steps 1 &amp;amp; 2&amp;#039;&amp;#039;&amp;#039;&lt;br /&gt;
&lt;br /&gt;
The first steps to any workflow involve single or multiple input datasets.&lt;br /&gt;
&lt;br /&gt;
For barcode splitting, we start with two input datasets, Step1 Input dataset and Step 2 input dataset&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=666</id>
		<title>Step 1 - Separating Multiplexed files into Libraries</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=666"/>
				<updated>2011-12-01T01:09:43Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Barcode Splitting Workflow Introduction==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
The workflow can be found at the following link: [http://knot.cnsi.ucsb.edu:8080/u/marko/w/barcodesplitter]&lt;br /&gt;
&lt;br /&gt;
The output from the illumina sequencing center at UC Davis produces two multiplexed Fastq format files (among thousands of others). &lt;br /&gt;
&lt;br /&gt;
These two files result from the paired-end sequencing run and are named S_6_1 (Left-hand reads) and S_6_3 (right hand reads) and contain all the data from all the species/samples that have have been pooled (multiplexed) into one lane. &lt;br /&gt;
&lt;br /&gt;
They will form the input for our workflow. &lt;br /&gt;
&lt;br /&gt;
The read containing /1 will be used as the left-hand read and the read containing /2 will be used as the right-hand read (see example below).&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Fastq Sanger format Left-hand Read:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
@HWI-EAS91_1_30788AAXX:7:21:1542:1758/1&lt;br /&gt;
&lt;br /&gt;
GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC&lt;br /&gt;
&lt;br /&gt;
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/1&lt;br /&gt;
&lt;br /&gt;
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Fastq Sanger format Right-hand Read:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
@HWI-EAS91_1_30788AAXX:7:21:1542:1758/2&lt;br /&gt;
&lt;br /&gt;
GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA&lt;br /&gt;
&lt;br /&gt;
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/2&lt;br /&gt;
&lt;br /&gt;
hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Currently, our output from UC Davis for right hand reads contains a /3 instead of the standard /2, so we will do a simple search and replace to correct this. More on this below.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Step by Step==&lt;br /&gt;
&lt;br /&gt;
Prior to beginning the workflow in Galaxy, we need to upload the paired-end fastq files to a history in Galaxy by using the Upload File tool under the Get Data tab. This process will take a while, but can be accelerated if the files are placed in a folder on the macroevolution server [http://macroevolution.lifesci.ucsb.edu/IlluminaData/]&lt;br /&gt;
&lt;br /&gt;
&amp;#039;&amp;#039;&amp;#039;Step 1 &amp;amp; 2&amp;#039;&amp;#039;&amp;#039;&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=665</id>
		<title>Step 1 - Separating Multiplexed files into Libraries</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=665"/>
				<updated>2011-12-01T01:02:34Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Barcode Splitting Workflow Introduction==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
The workflow can be found at the following link: [http://knot.cnsi.ucsb.edu:8080/u/marko/w/barcodesplitter]&lt;br /&gt;
&lt;br /&gt;
The output from the illumina sequencing center at UC Davis produces two multiplexed Fastq format files (among thousands of others). &lt;br /&gt;
&lt;br /&gt;
These two files result from the paired-end sequencing run and are named S_6_1 (Left-hand reads) and S_6_3 (right hand reads) and contain all the data from all the species/samples that have have been pooled (multiplexed) into one lane. &lt;br /&gt;
&lt;br /&gt;
They will form the input for our workflow. &lt;br /&gt;
&lt;br /&gt;
The read containing /1 will be used as the left-hand read and the read containing /2 will be used as the right-hand read (see example below).&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Fastq Sanger format Left-hand Read:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
@HWI-EAS91_1_30788AAXX:7:21:1542:1758/1&lt;br /&gt;
&lt;br /&gt;
GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC&lt;br /&gt;
&lt;br /&gt;
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/1&lt;br /&gt;
&lt;br /&gt;
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Fastq Sanger format Right-hand Read:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
@HWI-EAS91_1_30788AAXX:7:21:1542:1758/2&lt;br /&gt;
&lt;br /&gt;
GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA&lt;br /&gt;
&lt;br /&gt;
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/2&lt;br /&gt;
&lt;br /&gt;
hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Currently, our output from UC Davis for right hand reads contains a /3 instead of the standard /2, so we will do a simple search and replace to correct this. More on this below.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Step by Step==&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=664</id>
		<title>Step 1 - Separating Multiplexed files into Libraries</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=664"/>
				<updated>2011-12-01T01:00:57Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Barcode Splitting Workflow==&lt;br /&gt;
&lt;br /&gt;
&amp;#039;&amp;#039;&amp;#039;Introduction&amp;#039;&amp;#039;&amp;#039;&lt;br /&gt;
&lt;br /&gt;
The workflow can be found at the following link: [http://knot.cnsi.ucsb.edu:8080/u/marko/w/barcodesplitter]&lt;br /&gt;
&lt;br /&gt;
The output from the illumina sequencing center at UC Davis produces two multiplexed Fastq format files (among thousands of others). &lt;br /&gt;
&lt;br /&gt;
These two files result from the paired-end sequencing run and are named S_6_1 (Left-hand reads) and S_6_3 (right hand reads) and contain all the data from all the species/samples that have have been pooled (multiplexed) into one lane. &lt;br /&gt;
&lt;br /&gt;
They will form the input for our workflow. &lt;br /&gt;
&lt;br /&gt;
The read containing /1 will be used as the left-hand read and the read containing /2 will be used as the right-hand read (see example below).&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Fastq Sanger format Left-hand Read:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
@HWI-EAS91_1_30788AAXX:7:21:1542:1758/1&lt;br /&gt;
&lt;br /&gt;
GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC&lt;br /&gt;
&lt;br /&gt;
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/1&lt;br /&gt;
&lt;br /&gt;
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Fastq Sanger format Right-hand Read:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
@HWI-EAS91_1_30788AAXX:7:21:1542:1758/2&lt;br /&gt;
&lt;br /&gt;
GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA&lt;br /&gt;
&lt;br /&gt;
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/2&lt;br /&gt;
&lt;br /&gt;
hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Currently, our output from UC Davis for right hand reads contains a /3 instead of the standard /2, so we will do a simple search and replace to correct this.&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=663</id>
		<title>Step 1 - Separating Multiplexed files into Libraries</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=663"/>
				<updated>2011-12-01T00:59:09Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;#039;&amp;#039;&amp;#039;Barcode Splitting Workflow&amp;#039;&amp;#039;&amp;#039;&lt;br /&gt;
&lt;br /&gt;
Introduction&lt;br /&gt;
&lt;br /&gt;
The workflow can be found at the following link: [http://knot.cnsi.ucsb.edu:8080/u/marko/w/barcodesplitter]&lt;br /&gt;
&lt;br /&gt;
The output from the illumina sequencing center at UC Davis produces two multiplexed Fastq format files (among thousands of others). &lt;br /&gt;
&lt;br /&gt;
These two files result from the paired-end sequencing run and are named S_6_1 (Left-hand reads) and S_6_3 (right hand reads) and contain all the data from all the species/samples that have have been pooled (multiplexed) into one lane. &lt;br /&gt;
&lt;br /&gt;
They will form the input for our workflow. &lt;br /&gt;
&lt;br /&gt;
The read containing /1 will be used as the left-hand read and the read containing /2 will be used as the right-hand read (see example below).&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Fastq Sanger format Left-hand Read:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
@HWI-EAS91_1_30788AAXX:7:21:1542:1758/1&lt;br /&gt;
&lt;br /&gt;
GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC&lt;br /&gt;
&lt;br /&gt;
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/1&lt;br /&gt;
&lt;br /&gt;
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Fastq Sanger format Right-hand Read:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
@HWI-EAS91_1_30788AAXX:7:21:1542:1758/2&lt;br /&gt;
&lt;br /&gt;
GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA&lt;br /&gt;
&lt;br /&gt;
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/2&lt;br /&gt;
&lt;br /&gt;
hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Currently, our output from UC Davis for right hand reads contains a /3 instead of the standard /2, so we will do a simple search and replace to correct this.&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=662</id>
		<title>Step 1 - Separating Multiplexed files into Libraries</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=662"/>
				<updated>2011-11-30T23:15:38Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;#039;&amp;#039;&amp;#039;Barcode Splitting Workflow&amp;#039;&amp;#039;&amp;#039;&lt;br /&gt;
&lt;br /&gt;
The output from the illumina sequencing center at UC Davis produces two multiplexed Fastq format files (among thousands of others). &lt;br /&gt;
&lt;br /&gt;
These two files result from the paired-end sequencing run and are named S_6_1 (Left-hand reads) and S_6_3 (right hand reads) and contain all the data from all the species/samples that have have been pooled (multiplexed) into one lane. &lt;br /&gt;
&lt;br /&gt;
They will form the input for our workflow. &lt;br /&gt;
&lt;br /&gt;
The read containing /1 will be used as the left-hand read and the read containing /2 will be used as the right-hand read (see example below).&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Fastq Sanger format Left-hand Read:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
@HWI-EAS91_1_30788AAXX:7:21:1542:1758/1&lt;br /&gt;
&lt;br /&gt;
GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC&lt;br /&gt;
&lt;br /&gt;
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/1&lt;br /&gt;
&lt;br /&gt;
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Fastq Sanger format Right-hand Read:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
@HWI-EAS91_1_30788AAXX:7:21:1542:1758/2&lt;br /&gt;
&lt;br /&gt;
GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA&lt;br /&gt;
&lt;br /&gt;
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/2&lt;br /&gt;
&lt;br /&gt;
hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Currently, our output from UC Davis for right hand reads contains a /3 instead of the standard /2, so we will do a simple search and replace to correct this.&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=661</id>
		<title>Step 1 - Separating Multiplexed files into Libraries</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=661"/>
				<updated>2011-11-30T23:14:31Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;#039;&amp;#039;&amp;#039;Barcode Splitting Workflow&amp;#039;&amp;#039;&amp;#039;&lt;br /&gt;
&lt;br /&gt;
The output from the illumina sequencing center at UC Davis produces two multiplexed Fastq format files (among thousands of others). &lt;br /&gt;
&lt;br /&gt;
These two files result from the paired-end sequencing run and are named S_6_1 (Left-hand reads) and S_6_3 (right hand reads). They will form the input for our workflow. &lt;br /&gt;
&lt;br /&gt;
The read containing /1 will be used as the left-hand read and the read containing /2 will be used as the right-hand read (see example below).&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Fastq Sanger format Left-hand Read:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
@HWI-EAS91_1_30788AAXX:7:21:1542:1758/1&lt;br /&gt;
&lt;br /&gt;
GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC&lt;br /&gt;
&lt;br /&gt;
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/1&lt;br /&gt;
&lt;br /&gt;
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Fastq Sanger format Right-hand Read:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
@HWI-EAS91_1_30788AAXX:7:21:1542:1758/2&lt;br /&gt;
&lt;br /&gt;
GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA&lt;br /&gt;
&lt;br /&gt;
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/2&lt;br /&gt;
&lt;br /&gt;
hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Currently, our output from UC Davis for right hand reads contains a /3 instead of the standard /2, so we will do a simple search and replace to correct this.&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=660</id>
		<title>Step 1 - Separating Multiplexed files into Libraries</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=660"/>
				<updated>2011-11-30T23:12:39Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;#039;&amp;#039;&amp;#039;Barcode Splitting Workflow&amp;#039;&amp;#039;&amp;#039;&lt;br /&gt;
&lt;br /&gt;
The output from the illumina sequencing center at UC Davis produces two multiplexed Fastq format files (among thousands of others). &lt;br /&gt;
&lt;br /&gt;
These two files result from the paired-end sequencing run and are named S_6_1 (Left-hand reads) and S_6_3 (right hand reads). They will form the input for our workflow. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Fastq Sanger format Left-hand Read:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
@HWI-EAS91_1_30788AAXX:7:21:1542:1758/1&lt;br /&gt;
&lt;br /&gt;
GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC&lt;br /&gt;
&lt;br /&gt;
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/1&lt;br /&gt;
&lt;br /&gt;
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Fastq Sanger format Right-hand Read:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
@HWI-EAS91_1_30788AAXX:7:21:1542:1758/2&lt;br /&gt;
&lt;br /&gt;
GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA&lt;br /&gt;
&lt;br /&gt;
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/2&lt;br /&gt;
&lt;br /&gt;
hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=659</id>
		<title>Step 1 - Separating Multiplexed files into Libraries</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=659"/>
				<updated>2011-11-30T23:12:24Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;#039;&amp;#039;&amp;#039;Barcode Splitting Workflow&amp;#039;&amp;#039;&amp;#039;&lt;br /&gt;
&lt;br /&gt;
The output from the illumina sequencing center at UC Davis produces two multiplexed Fastq format files (among thousands of others). &lt;br /&gt;
&lt;br /&gt;
These two files result from the paired-end sequencing run and are named S_6_1 (Left-hand reads) and S_6_3 (right hand reads). They will form the input for our workflow. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Fastq Sanger format Left-hand Read:&lt;br /&gt;
&lt;br /&gt;
@HWI-EAS91_1_30788AAXX:7:21:1542:1758/1&lt;br /&gt;
&lt;br /&gt;
GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC&lt;br /&gt;
&lt;br /&gt;
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/1&lt;br /&gt;
&lt;br /&gt;
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Fastq Sanger format Right-hand Read:&lt;br /&gt;
&lt;br /&gt;
@HWI-EAS91_1_30788AAXX:7:21:1542:1758/2&lt;br /&gt;
&lt;br /&gt;
GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA&lt;br /&gt;
&lt;br /&gt;
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/2&lt;br /&gt;
&lt;br /&gt;
hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=658</id>
		<title>Step 1 - Separating Multiplexed files into Libraries</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=658"/>
				<updated>2011-11-30T23:12:00Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;#039;&amp;#039;&amp;#039;Barcode Splitting Workflow&amp;#039;&amp;#039;&amp;#039;&lt;br /&gt;
&lt;br /&gt;
The output from the illumina sequencing center at UC Davis produces two multiplexed Fastq format files (among thousands of others). &lt;br /&gt;
&lt;br /&gt;
These two files result from the paired-end sequencing run and are named S_6_1 (Left-hand reads) and S_6_3 (right hand reads). They will form the input for our workflow. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Fastq Sanger format Left-hand Read:&lt;br /&gt;
&lt;br /&gt;
@HWI-EAS91_1_30788AAXX:7:21:1542:1758/1&lt;br /&gt;
GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC&lt;br /&gt;
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/1&lt;br /&gt;
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Fastq Sanger format Right-hand Read:&lt;br /&gt;
&lt;br /&gt;
@HWI-EAS91_1_30788AAXX:7:21:1542:1758/2&lt;br /&gt;
GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA&lt;br /&gt;
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/2&lt;br /&gt;
hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=652</id>
		<title>Step 1 - Separating Multiplexed files into Libraries</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Step_1_-_Separating_Multiplexed_files_into_Libraries&amp;diff=652"/>
				<updated>2011-11-30T23:03:46Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: Created page with &amp;quot;&amp;#039;&amp;#039;&amp;#039;Barcode Splitting Workflow&amp;#039;&amp;#039;&amp;#039;&amp;quot;&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;#039;&amp;#039;&amp;#039;Barcode Splitting Workflow&amp;#039;&amp;#039;&amp;#039;&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Galaxy_illumina_Data_Processing&amp;diff=651</id>
		<title>Galaxy illumina Data Processing</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Galaxy_illumina_Data_Processing&amp;diff=651"/>
				<updated>2011-11-30T23:02:21Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: Created page with &amp;quot;*Step 1 - Separating Multiplexed files into Libraries&amp;quot;&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;*[[Step 1 - Separating Multiplexed files into Libraries]]&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=UCSB_Galaxy_Documentation&amp;diff=648</id>
		<title>UCSB Galaxy Documentation</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=UCSB_Galaxy_Documentation&amp;diff=648"/>
				<updated>2011-11-30T23:00:30Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== &amp;#039;&amp;#039;&amp;#039;Galaxy Topics&amp;#039;&amp;#039;&amp;#039; ==&lt;br /&gt;
* [[Using UCSB Galaxy]]&lt;br /&gt;
*[[Galaxy Development Priorities]]&lt;br /&gt;
* [[Galaxy Problems to address]]&lt;br /&gt;
* [[Galaxy Tool Tips and Troubleshooting]]&lt;br /&gt;
* [[Galaxy illumina Data Processing]]&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Lab_Inventory&amp;diff=642</id>
		<title>Lab Inventory</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Lab_Inventory&amp;diff=642"/>
				<updated>2011-11-29T23:43:30Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;[http://macroevolution.lifesci.ucsb.edu/IlluminaData/wikifiles/Labinventory_v112011.pdf Lab Inventory]&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Lab_Inventory&amp;diff=641</id>
		<title>Lab Inventory</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Lab_Inventory&amp;diff=641"/>
				<updated>2011-11-29T23:43:15Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;[http://macroevolution.lifesci.ucsb.edu/IlluminaData/wikifiles/Labinventory_v112011.pdf]&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Dimensions_of_Biodiversity&amp;diff=525</id>
		<title>Dimensions of Biodiversity</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Dimensions_of_Biodiversity&amp;diff=525"/>
				<updated>2011-11-22T17:13:15Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: /* Brief Project Description */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Brief Project Description==&lt;br /&gt;
&lt;br /&gt;
We are working on a collaborative NSF grant focusing on the dimensions of biodiversity. We aim to create a new molecular phylogeny that can be used to test whether assemblages of freshwater planktonic green algae across North America are more genetically diverse than predicted by chance. This project will involve experimental manipulation of the evolutionary and genetic divergence of species to assess how these aspects of biological diversity control niche differences and community productivity. Subsequently, transcriptome analyses will be conducted to identify the genetic basis of niche differentiation among species, and relate these to the production of biomass by phytoplankton communities.&lt;br /&gt;
&lt;br /&gt;
This project is part of a collaboration between the Cardinale Lab at U. Michigan, the Delwiche Lab of U. Maryland and the Oakley Lab at UCSB.&lt;br /&gt;
&lt;br /&gt;
==Interdisciplinary Approach==&lt;br /&gt;
&lt;br /&gt;
[[File:exp1.jpg]]&lt;br /&gt;
&lt;br /&gt;
==Community Phylogenetics==&lt;br /&gt;
&lt;br /&gt;
[[File:exp2.jpg]]&lt;br /&gt;
&lt;br /&gt;
==Predicted Outcomes==&lt;br /&gt;
&lt;br /&gt;
[[File:Pred1.jpg]]&lt;br /&gt;
[[File:Pred2.jpg]]&lt;br /&gt;
[[File:Pred3.jpg]]&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Birds_of_Melanesia&amp;diff=524</id>
		<title>Birds of Melanesia</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Birds_of_Melanesia&amp;diff=524"/>
				<updated>2011-11-22T02:55:52Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: /* Phylogenetic Community Structure of the Birds of Melanesia */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Phylogenetic Community Structure of the Birds of Melanesia==&lt;br /&gt;
[[File:Fiji.jpg]]&lt;br /&gt;
Species Checklist:  http://birdsofmelanesia.net/&lt;br /&gt;
&lt;br /&gt;
Taxonomic Database: http://avibase.bsc-eoc.org/&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[File:melanesia1.jpg]]&lt;br /&gt;
[[File:melanesia2.jpg]]&lt;br /&gt;
[[File:melanesia3.jpg]]&lt;br /&gt;
[[File:melanesia4.jpg]]&lt;br /&gt;
&lt;br /&gt;
[[File:melanesiamap.jpg]]&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=File:Melanesiamap.jpg&amp;diff=523</id>
		<title>File:Melanesiamap.jpg</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=File:Melanesiamap.jpg&amp;diff=523"/>
				<updated>2011-11-22T02:54:30Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=File:Fiji.jpg&amp;diff=522</id>
		<title>File:Fiji.jpg</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=File:Fiji.jpg&amp;diff=522"/>
				<updated>2011-11-22T02:54:11Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=File:Melanesia4.jpg&amp;diff=521</id>
		<title>File:Melanesia4.jpg</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=File:Melanesia4.jpg&amp;diff=521"/>
				<updated>2011-11-22T02:53:58Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=File:Melanesia3.jpg&amp;diff=520</id>
		<title>File:Melanesia3.jpg</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=File:Melanesia3.jpg&amp;diff=520"/>
				<updated>2011-11-22T02:53:46Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=File:Melanesia2.jpg&amp;diff=519</id>
		<title>File:Melanesia2.jpg</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=File:Melanesia2.jpg&amp;diff=519"/>
				<updated>2011-11-22T02:53:36Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=File:Melanesia1.jpg&amp;diff=518</id>
		<title>File:Melanesia1.jpg</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=File:Melanesia1.jpg&amp;diff=518"/>
				<updated>2011-11-22T02:53:26Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Birds_of_Melanesia&amp;diff=517</id>
		<title>Birds of Melanesia</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Birds_of_Melanesia&amp;diff=517"/>
				<updated>2011-11-22T02:52:13Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Phylogenetic Community Structure of the Birds of Melanesia==&lt;br /&gt;
&lt;br /&gt;
Species Checklist:  http://birdsofmelanesia.net/&lt;br /&gt;
&lt;br /&gt;
Taxonomic Database: http://avibase.bsc-eoc.org/&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Birds_of_Melanesia&amp;diff=516</id>
		<title>Birds of Melanesia</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Birds_of_Melanesia&amp;diff=516"/>
				<updated>2011-11-22T02:51:44Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: /* Phylogenetic Community Structure of the Birds of Melanesia */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Phylogenetic Community Structure of the Birds of Melanesia==&lt;br /&gt;
&lt;br /&gt;
Species Checklist:  http://birdsofmelanesia.net/&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Salmonid_Divergence_Times&amp;diff=515</id>
		<title>Salmonid Divergence Times</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Salmonid_Divergence_Times&amp;diff=515"/>
				<updated>2011-11-22T02:37:16Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: /* Reconstructing Anadromy in Salmonids */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Reconstructing Anadromy in Salmonids==&lt;br /&gt;
[[File:jump.jpg]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[File:States.jpg]]&lt;br /&gt;
&lt;br /&gt;
[[File:anadromy.jpg]]&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=File:Jump.jpg&amp;diff=514</id>
		<title>File:Jump.jpg</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=File:Jump.jpg&amp;diff=514"/>
				<updated>2011-11-22T02:36:27Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=File:Anadromy.jpg&amp;diff=513</id>
		<title>File:Anadromy.jpg</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=File:Anadromy.jpg&amp;diff=513"/>
				<updated>2011-11-22T02:36:16Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Salmonid_Divergence_Times&amp;diff=512</id>
		<title>Salmonid Divergence Times</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Salmonid_Divergence_Times&amp;diff=512"/>
				<updated>2011-11-22T02:36:00Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Reconstructing Anadromy in Salmonids==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[File:States.jpg]]&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=File:States.jpg&amp;diff=511</id>
		<title>File:States.jpg</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=File:States.jpg&amp;diff=511"/>
				<updated>2011-11-22T02:35:33Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Birds_of_Melanesia&amp;diff=510</id>
		<title>Birds of Melanesia</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Birds_of_Melanesia&amp;diff=510"/>
				<updated>2011-11-22T02:23:53Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: Created page with &amp;quot;==Phylogenetic Community Structure of the Birds of Melanesia==&amp;quot;&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Phylogenetic Community Structure of the Birds of Melanesia==&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Salmonid_Divergence_Times&amp;diff=509</id>
		<title>Salmonid Divergence Times</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Salmonid_Divergence_Times&amp;diff=509"/>
				<updated>2011-11-22T02:23:17Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: Created page with &amp;quot;==Reconstructing Anadromy in Salmonids==&amp;quot;&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Reconstructing Anadromy in Salmonids==&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Dimensions_of_Biodiversity&amp;diff=508</id>
		<title>Dimensions of Biodiversity</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Dimensions_of_Biodiversity&amp;diff=508"/>
				<updated>2011-11-22T02:21:36Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Brief Project Description==&lt;br /&gt;
&lt;br /&gt;
I am working on a collaborative NSF grant focusing on the dimensions of biodiversity. I aim to create a new molecular phylogeny that can be used to test whether assemblages of freshwater planktonic green algae across North America are more genetically diverse than predicted by chance. This project will involve experimental manipulation of the evolutionary and genetic divergence of species to assess how these aspects of biological diversity control niche differences and community productivity. Subsequently, transcriptome analyses will be conducted to identify the genetic basis of niche differentiation among species, and relate these to the production of biomass by phytoplankton communities.&lt;br /&gt;
&lt;br /&gt;
This project is part of a collaboration between the Cardinale Lab at U. Michigan, the Delwiche Lab of U. Maryland and the Oakley Lab at UCSB.&lt;br /&gt;
&lt;br /&gt;
==Interdisciplinary Approach==&lt;br /&gt;
&lt;br /&gt;
[[File:exp1.jpg]]&lt;br /&gt;
&lt;br /&gt;
==Community Phylogenetics==&lt;br /&gt;
&lt;br /&gt;
[[File:exp2.jpg]]&lt;br /&gt;
&lt;br /&gt;
==Predicted Outcomes==&lt;br /&gt;
&lt;br /&gt;
[[File:Pred1.jpg]]&lt;br /&gt;
[[File:Pred2.jpg]]&lt;br /&gt;
[[File:Pred3.jpg]]&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Dimensions_of_Biodiversity&amp;diff=507</id>
		<title>Dimensions of Biodiversity</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Dimensions_of_Biodiversity&amp;diff=507"/>
				<updated>2011-11-22T02:20:42Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Brief Project Description==&lt;br /&gt;
&lt;br /&gt;
I am working on a collaborative NSF grant focusing on the dimensions of biodiversity. I aim to create a new molecular phylogeny that can be used to test whether assemblages of freshwater planktonic green algae across North America are more genetically diverse than predicted by chance. This project will involve experimental manipulation of the evolutionary and genetic divergence of species to assess how these aspects of biological diversity control niche differences and community productivity. Subsequently, transcriptome analyses will be conducted to identify the genetic basis of niche differentiation among species, and relate these to the production of biomass by phytoplankton communities.&lt;br /&gt;
&lt;br /&gt;
This project is part of a collaboration between the Cardinale Lab at U. Michigan, the Delwiche Lab of U. Maryland and the Oakley Lab at UCSB.&lt;br /&gt;
&lt;br /&gt;
==Interdisciplinary Approach==&lt;br /&gt;
&lt;br /&gt;
[[File:exp1.jpg]]&lt;br /&gt;
&lt;br /&gt;
==Community Phylogenetics==&lt;br /&gt;
&lt;br /&gt;
[[File:exp2.jpg]]&lt;br /&gt;
&lt;br /&gt;
==Predictions==&lt;br /&gt;
&lt;br /&gt;
[[File:Pred1.jpg]]&lt;br /&gt;
[[File:Pred2.jpg]]&lt;br /&gt;
[[File:Pred3.jpg]]&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Dimensions_of_Biodiversity&amp;diff=506</id>
		<title>Dimensions of Biodiversity</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Dimensions_of_Biodiversity&amp;diff=506"/>
				<updated>2011-11-22T02:20:02Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Brief Project Description==&lt;br /&gt;
&lt;br /&gt;
I am working on a collaborative NSF grant focusing on the dimensions of biodiversity. I aim to create a new molecular phylogeny that can be used to test whether assemblages of freshwater planktonic green algae across North America are more genetically diverse than predicted by chance. This project will involve experimental manipulation of the evolutionary and genetic divergence of species to assess how these aspects of biological diversity control niche differences and community productivity. Subsequently, transcriptome analyses will be conducted to identify the genetic basis of niche differentiation among species, and relate these to the production of biomass by phytoplankton communities.&lt;br /&gt;
&lt;br /&gt;
This project is part of a collaboration between the Cardinale Lab at U. Michigan, the Delwiche Lab of U. Maryland and the Oakley Lab at UCSB.&lt;br /&gt;
&lt;br /&gt;
==Interdisciplinary Approach==&lt;br /&gt;
&lt;br /&gt;
[[File:exp1.jpg]]&lt;br /&gt;
&lt;br /&gt;
&amp;#039;&amp;#039;&amp;#039;Figure 2&amp;#039;&amp;#039;&amp;#039;&lt;br /&gt;
&lt;br /&gt;
[[File:exp2.jpg]]&lt;br /&gt;
&lt;br /&gt;
&amp;#039;&amp;#039;&amp;#039;Predictions&amp;#039;&amp;#039;&amp;#039;&lt;br /&gt;
&lt;br /&gt;
[[File:Pred1.jpg]]&lt;br /&gt;
[[File:Pred2.jpg]]&lt;br /&gt;
[[File:Pred3.jpg]]&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Dimensions_of_Biodiversity&amp;diff=505</id>
		<title>Dimensions of Biodiversity</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Dimensions_of_Biodiversity&amp;diff=505"/>
				<updated>2011-11-22T02:19:02Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Brief Project Description==&lt;br /&gt;
&lt;br /&gt;
I am working on a collaborative NSF grant focusing on the dimensions of biodiversity. I aim to create a new molecular phylogeny that can be used to test whether assemblages of freshwater planktonic green algae across North America are more genetically diverse than predicted by chance. This project will involve experimental manipulation of the evolutionary and genetic divergence of species to assess how these aspects of biological diversity control niche differences and community productivity. Subsequently, transcriptome analyses will be conducted to identify the genetic basis of niche differentiation among species, and relate these to the production of biomass by phytoplankton communities.&lt;br /&gt;
&lt;br /&gt;
This project is part of a collaboration between the Cardinale Lab at U. Michigan, the Delwiche Lab of U. Maryland and the Oakley Lab at UCSB.&lt;br /&gt;
&lt;br /&gt;
&amp;#039;&amp;#039;&amp;#039;Figure 1&amp;#039;&amp;#039;&amp;#039;&lt;br /&gt;
&lt;br /&gt;
[[File:exp1.jpg]]&lt;br /&gt;
&lt;br /&gt;
&amp;#039;&amp;#039;&amp;#039;Figure 2&amp;#039;&amp;#039;&amp;#039;&lt;br /&gt;
&lt;br /&gt;
[[File:exp2.jpg]]&lt;br /&gt;
&lt;br /&gt;
&amp;#039;&amp;#039;&amp;#039;Predictions&amp;#039;&amp;#039;&amp;#039;&lt;br /&gt;
&lt;br /&gt;
[[File:Pred1.jpg]]&lt;br /&gt;
[[File:Pred2.jpg]]&lt;br /&gt;
[[File:Pred3.jpg]]&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	<entry>
		<id>https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Galaxy_Development_Priorities&amp;diff=504</id>
		<title>Galaxy Development Priorities</title>
		<link rel="alternate" type="text/html" href="https://osiris.eemb.ucsb.edu/wiki/galaxyucsb/index.php?title=Galaxy_Development_Priorities&amp;diff=504"/>
				<updated>2011-11-22T02:18:20Z</updated>
		
		<summary type="html">&lt;p&gt;Marko: /* To Add */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Roger&amp;#039;s Current Tasks==&lt;br /&gt;
*[[Evolmap output]]&lt;br /&gt;
*[[Implement EvolMap -- Assigned to Roger]]&lt;br /&gt;
&lt;br /&gt;
==Karl&amp;#039;s Current Tasks==&lt;br /&gt;
*[[Implement Beast]]&lt;br /&gt;
*[[Add proxy on macroevolution]]&lt;br /&gt;
*[[monit]]&lt;br /&gt;
*[[Debug search and replace]]&lt;br /&gt;
&lt;br /&gt;
==To Add==&lt;br /&gt;
*[[Multiple instances]]&lt;br /&gt;
*[[Implement Hammstr - an external pipeline of tools]]&lt;br /&gt;
*[[Implement TransAbyss pipeline]]&lt;br /&gt;
*[[Implement Davis&amp;#039; Illumina Scripts]]&lt;br /&gt;
*[[Implement RAxML]]&lt;br /&gt;
*[[Implement r8s]]&lt;br /&gt;
*[[Implement sequence alignment tools, MUSCLE MAFFT PROALIGN]]&lt;br /&gt;
*[[Implement phylogenetics scripts like format converters and concatenation tools]]&lt;br /&gt;
*[[Implement NCBI&amp;#039;s tools from SRA Toolkit]]&lt;br /&gt;
&lt;br /&gt;
==Added==&lt;br /&gt;
*[[Recently enabled tools]]&lt;br /&gt;
*[[Regular Expression Search and replace  -- Assigned to Karl]]&lt;/div&gt;</summary>
		<author><name>Marko</name></author>	</entry>

	</feed>