CDNA Synthesis - Revision history

Marko at 00:34, 19 November 2011

2011-11-19T00:34:56Z

2011-11-19T00:34:38Z

2011-11-18T22:39:23Z

2011-11-18T22:38:26Z

2011-11-18T22:37:48Z

2011-11-18T22:36:58Z

2011-11-18T22:36:45Z

2011-11-18T22:36:09Z

2011-11-18T22:36:00Z

2011-11-18T22:35:44Z

← Older revision		Revision as of 00:34, 19 November 2011
Line 1:		Line 1:
−	'''First Strand Synthesis (modified from [Clontech SMARTer Pico cDNA Synthesis Kit])'''	+	'''First Strand Synthesis (modified from Clontech SMARTer Pico cDNA Synthesis Kit)'''

← Older revision		Revision as of 00:34, 19 November 2011
Line 1:		Line 1:
−	'''First Strand Synthesis (modified from Clontech SMARTer Pico cDNA Synthesis Kit)'''	+	'''First Strand Synthesis (modified from [Clontech SMARTer Pico cDNA Synthesis Kit])'''

← Older revision		Revision as of 22:39, 18 November 2011
Line 1:		Line 1:
	'''First Strand Synthesis (modified from Clontech SMARTer Pico cDNA Synthesis Kit)'''		'''First Strand Synthesis (modified from Clontech SMARTer Pico cDNA Synthesis Kit)'''
		+

	Starting concentration of total RNA for Clontech SMARTer cDNA Kit 1-20ng/µl		Starting concentration of total RNA for Clontech SMARTer cDNA Kit 1-20ng/µl

@@ Line 81: / Line 81: @@
 ˚C 1 min
 – 24 X cycles:
 ˚C 15 sec
 ˚C 30 sec
 ˚C 6 mins
 . Optional: Quantify ds cDNA at different cycles to optimize. I use 24 cycles for most species.
 . Optional: Combine final product into 1 tube.
 . Quantify total ds cDNA using high sensitivity Qubit reagents and/or gel. Typical yields of 2-25 µg total ds cDNA.
 . Purify PCR product using Agencourt Ampure XP beads (available from Beckman). Follow manual provided.

← Older revision		Revision as of 22:37, 18 November 2011
Line 49:		Line 49:

	8. Dilute the final product by adding 30 µL of TE Buffer/dH20 (i.e. total of 40 µL of ss cDNA for each starting RNA extraction).		8. Dilute the final product by adding 30 µL of TE Buffer/dH20 (i.e. total of 40 µL of ss cDNA for each starting RNA extraction).
		+
		+
		+	'''Second strand synthesis (modified from Clontech Advantage 2 PCR Kit)'''
		+
		+
		+	1. Aliquot 10 µL of diluted ss cDNA into 4 labeled 0.5 mL reaction tubes.
		+
		+
		+	2. Make a master mix for each reaction +1, using the following:
		+
		+	74 µL Di H20
		+
		+	10 µL 10X Advantage 2 PCR Buffer
		+
		+	2 µL 50X dNTP Mix (10 mM)
		+
		+	2 µL 5’ PCR Primer IIA (12 uM)
		+
		+	2 µL 50X Advantage 2 polymerase Mix
		+
		+	90 µL total reaction volume
		+
		+
		+	3. Mix well by vortexing and briefly spin.
		+
		+
		+	4. Aliquot 90 µL of master mix into each tube from step 2.
		+
		+
		+	5. Commence thermocycling using the following program:
		+
		+	95˚C 1 min
		+	21 – 24 X cycles:
		+	95˚C 15 sec
		+	65˚C 30 sec
		+	68˚C 6 mins
		+
		+	6. Optional: Quantify ds cDNA at different cycles to optimize. I use 24 cycles for most species.
		+
		+	7. Optional: Combine final product into 1 tube.
		+
		+	8. Quantify total ds cDNA using high sensitivity Qubit reagents and/or gel. Typical yields of 2-25 µg total ds cDNA.
		+
		+	9. Purify PCR product using Agencourt Ampure XP beads (available from Beckman). Follow manual provided.

@@ Line 40: / Line 40: @@
 . Aliquot 5.5 µL of the master mix into each reaction tube.  Mix the contents of the tube by gently pipetting and spin tubes briefly to collect contents.
 .  Incubate at 42˚C for 90 mins.
 .  Terminate the reaction by heating at 72˚C for 10 min.
 .  Dilute the final product by adding 30 µL of TE Buffer/dH20 (i.e. total of 40 µL of ss cDNA for each starting RNA extraction).

@@ Line 12: / Line 12: @@
 Modified 3’ SMART CDS Primer II A: AAGCAGTGGTATCAACGCAGAGTACTTTTTTCTTTTTT
 . Mix contents and spin tubes briefly in a microcentrifuge
 . Incubate tubes at 72˚C for 3 min, then 42˚C for 2 min
 	**DO NOT DELAY BETWEEN STEPS 3 and 4!
 . Prepare a master mix for each reaction tube by combining the following reagents:
 µL 5X 1st strand buffer
 .25 µL DTT (100 mM)
 µL dNTP mix (10 mM)
 µL SMARTer II A Oligonucleotide (12 uM)
 .25 µL RNAse inhibitor
 µL SMARTScribe Reverse Transcriptase (100 U)
 .5 µL total reaction volume
 . Aliquot 5.5 µL of the master mix into each reaction tube.  Mix the contents of the tube by gently pipetting and spin tubes briefly to collect contents.

@@ Line 6: / Line 6: @@
 .5 µL total RNA
 µL modified 3’ SMART CDS Primer II A (12 uM)
 .5 µL total volume

@@ Line 3: / Line 3: @@
 Starting concentration of total RNA for Clontech SMARTer cDNA Kit 1-20ng/µl
 . Combine the following reagents into separate 0.5 ml reaction tubes for each sample:
 .5 µL total RNA
 µL modified 3’ SMART CDS Primer II A (12 uM)