Phylocatenator.pl - Revision history

Oakley at 06:38, 22 December 2011

2011-12-22T06:38:28Z

Oakley at 06:32, 22 December 2011

2011-12-22T06:32:21Z

Oakley: Created page with "What it does This tool written by THO in perl and implemented in Galaxy that produces a concatenated data set for phylogenetics when not all genes are sampled for all species. …"

2011-12-22T06:30:46Z

Created page with "What it does This tool written by THO in perl and implemented in Galaxy that produces a concatenated data set for phylogenetics when not all genes are sampled for all species. …"

New page

What it does

This tool written by THO in perl and implemented in Galaxy that produces a concatenated data set for phylogenetics when not all genes are sampled for all species.

Basic Example

The input data must be in column format. Column 1 is species name, C2 is genefamily, C3 individual gene name, C4 is sequence. Sequences of each gene family must be aligned:

species1 gene1 genenameA acgttagcgcgctatagc
species2 gene1 genenameB acgttag--cgctataaa
species3 gene1 genenameC acgttagcgcgctatagc
species4 gene1 genenameD acgttagcgcgctatagc
species1 gene2 genenameE --gttagtttgcta
species3 gene2 genenameF gtgttagtttgcta

Two variables are $gene and $species. These set thresholds for inclusion of data. $species is the minimum number of species that contain a particular gene. $gene sets a minimum number of gene families that a species must have to be included in the dataset.

Running phylocatenator on the above data with 0 for genes and 0 for species yields:

4 32
species1 acgttagcgcgctatagc--gttagtttgcta
species2 acgttag--cgctataaa??????????????
species3 acgttagcgcgctatagcgtgttagtttgcta
species4 acgttagcgcgctatagc??????????????
Optional Functionality

I. You may enter a list of species. Species not in this list will not be written to the output file. For example, a species list of:

species1
species2
Would change the above output to:

species1 acgttagcgcgctatagc--gttagtttgcta
species2 acgttag--cgctataaa??????????????
Table of partition models
You may enter a table of models for each gene family/partition. Phylocatenator will then sort all the data to put all data for the same models together. It will then create the appropriate partition file, which will specify each model in raxml. Currently, it is only possible to partiion data into valid raxml models.

The format is a tab-delimited file as follows:

gene1 WAG
gene2 JTT
gene3 DNA
gene4 WAG
Valid models include the following:

BIN = binary morphological data
MULTI = multistate morphological data
DNA = DNA data
WAG = one of several protein models listed in raxml help documents

← Older revision		Revision as of 06:38, 22 December 2011
Line 54:		Line 54:
	DNA = DNA data		DNA = DNA data
	WAG = one of several protein models listed in raxml help documents		WAG = one of several protein models listed in raxml help documents
		+
		+	==Known Bugs==
		+	When MULTI data was excluded due to being too small an alignment to make the cut, it still showed up in the partition file, but the ending number was smaller than beginning number

@@ Line 1: / Line 1: @@
-What it does
+==What it does==
 This tool written by THO in perl and implemented in Galaxy that produces a concatenated data set for phylogenetics when not all genes are sampled for all species.
-Basic Example
+==Basic Example==
 The input data must be in column format. Column 1 is species name, C2 is genefamily, C3 individual gene name, C4 is sequence. Sequences of each gene family must be aligned:
@@ Line 19: / Line 19: @@
 Running phylocatenator on the above data with 0 for genes and 0 for species yields:
 32
-species1      acgttagcgcgctatagc--gttagtttgcta
+  species1      acgttagcgcgctatagc--gttagtttgcta
-species2      acgttag--cgctataaa??????????????
+  species2      acgttag--cgctataaa??????????????
-species3      acgttagcgcgctatagcgtgttagtttgcta
+  species3      acgttagcgcgctatagcgtgttagtttgcta
-species4      acgttagcgcgctatagc??????????????
+  species4      acgttagcgcgctatagc??????????????
 Optional Functionality
 I. You may enter a list of species. Species not in this list will not be written to the output file. For example, a species list of:
-species1
+  species1
-species2
+  species2
 Would change the above output to:
-species1      acgttagcgcgctatagc--gttagtttgcta
+  species1      acgttagcgcgctatagc--gttagtttgcta
-species2      acgttag--cgctataaa??????????????
+  species2      acgttag--cgctataaa??????????????
 Table of partition models
 You may enter a table of models for each gene family/partition. Phylocatenator will then sort all the data to put all data for the same models together. It will then create the appropriate partition file, which will specify each model in raxml. Currently, it is only possible to partiion data into valid raxml models.
 The format is a tab-delimited file as follows:
-gene1 WAG
+  gene1 WAG
-gene2 JTT
+  gene2 JTT
-gene3 DNA
+  gene3 DNA
-gene4 WAG
+  gene4 WAG
 Valid models include the following:
-BIN = binary morphological data
+  BIN = binary morphological data
-MULTI = multistate morphological data
+  MULTI = multistate morphological data
-DNA = DNA data
+  DNA = DNA data
-WAG = one of several protein models listed in raxml help documents
+  WAG = one of several protein models listed in raxml help documents