Difference between revisions of "CDNA Synthesis"
| (6 intermediate revisions by the same user not shown) | |||
| Line 1: | Line 1: | ||
'''First Strand Synthesis (modified from Clontech SMARTer Pico cDNA Synthesis Kit)''' | '''First Strand Synthesis (modified from Clontech SMARTer Pico cDNA Synthesis Kit)''' | ||
| + | |||
Starting concentration of total RNA for Clontech SMARTer cDNA Kit 1-20ng/µl | Starting concentration of total RNA for Clontech SMARTer cDNA Kit 1-20ng/µl | ||
| Line 12: | Line 13: | ||
Modified 3’ SMART CDS Primer II A: AAGCAGTGGTATCAACGCAGAGTACTTTTTTCTTTTTT | Modified 3’ SMART CDS Primer II A: AAGCAGTGGTATCAACGCAGAGTACTTTTTTCTTTTTT | ||
| + | |||
2. Mix contents and spin tubes briefly in a microcentrifuge | 2. Mix contents and spin tubes briefly in a microcentrifuge | ||
| + | |||
3. Incubate tubes at 72˚C for 3 min, then 42˚C for 2 min | 3. Incubate tubes at 72˚C for 3 min, then 42˚C for 2 min | ||
**DO NOT DELAY BETWEEN STEPS 3 and 4! | **DO NOT DELAY BETWEEN STEPS 3 and 4! | ||
| + | |||
4. Prepare a master mix for each reaction tube by combining the following reagents: | 4. Prepare a master mix for each reaction tube by combining the following reagents: | ||
| + | |||
2 µL 5X 1st strand buffer | 2 µL 5X 1st strand buffer | ||
| + | |||
0.25 µL DTT (100 mM) | 0.25 µL DTT (100 mM) | ||
| + | |||
1 µL dNTP mix (10 mM) | 1 µL dNTP mix (10 mM) | ||
| + | |||
1 µL SMARTer II A Oligonucleotide (12 uM) | 1 µL SMARTer II A Oligonucleotide (12 uM) | ||
| + | |||
0.25 µL RNAse inhibitor | 0.25 µL RNAse inhibitor | ||
| + | |||
1 µL SMARTScribe Reverse Transcriptase (100 U) | 1 µL SMARTScribe Reverse Transcriptase (100 U) | ||
| + | |||
5.5 µL total reaction volume | 5.5 µL total reaction volume | ||
| + | |||
5. Aliquot 5.5 µL of the master mix into each reaction tube. Mix the contents of the tube by gently pipetting and spin tubes briefly to collect contents. | 5. Aliquot 5.5 µL of the master mix into each reaction tube. Mix the contents of the tube by gently pipetting and spin tubes briefly to collect contents. | ||
| + | |||
6. Incubate at 42˚C for 90 mins. | 6. Incubate at 42˚C for 90 mins. | ||
| + | |||
7. Terminate the reaction by heating at 72˚C for 10 min. | 7. Terminate the reaction by heating at 72˚C for 10 min. | ||
| + | |||
8. Dilute the final product by adding 30 µL of TE Buffer/dH20 (i.e. total of 40 µL of ss cDNA for each starting RNA extraction). | 8. Dilute the final product by adding 30 µL of TE Buffer/dH20 (i.e. total of 40 µL of ss cDNA for each starting RNA extraction). | ||
| + | |||
| + | |||
| + | '''Second strand synthesis (modified from Clontech Advantage 2 PCR Kit)''' | ||
| + | |||
| + | |||
| + | 1. Aliquot 10 µL of diluted ss cDNA into 4 labeled 0.5 mL reaction tubes. | ||
| + | |||
| + | |||
| + | 2. Make a master mix for each reaction +1, using the following: | ||
| + | |||
| + | 74 µL Di H20 | ||
| + | |||
| + | 10 µL 10X Advantage 2 PCR Buffer | ||
| + | |||
| + | 2 µL 50X dNTP Mix (10 mM) | ||
| + | |||
| + | 2 µL 5’ PCR Primer IIA (12 uM) | ||
| + | |||
| + | 2 µL 50X Advantage 2 polymerase Mix | ||
| + | |||
| + | 90 µL total reaction volume | ||
| + | |||
| + | |||
| + | 3. Mix well by vortexing and briefly spin. | ||
| + | |||
| + | |||
| + | 4. Aliquot 90 µL of master mix into each tube from step 2. | ||
| + | |||
| + | |||
| + | 5. Commence thermocycling using the following program: | ||
| + | |||
| + | 95˚C 1 min | ||
| + | |||
| + | 21 – 24 X cycles: | ||
| + | |||
| + | 95˚C 15 sec | ||
| + | |||
| + | 65˚C 30 sec | ||
| + | |||
| + | 68˚C 6 mins | ||
| + | |||
| + | |||
| + | 6. Optional: Quantify ds cDNA at different cycles to optimize. I use 21- 24 cycles for most species. | ||
| + | |||
| + | |||
| + | 7. Optional: Combine final product into 1 tube. | ||
| + | |||
| + | |||
| + | 8. Quantify total ds cDNA using high sensitivity Qubit reagents and/or gel. Typical yields of 2-25 µg total ds cDNA. | ||
| + | |||
| + | |||
| + | 9. Purify PCR product using Agencourt Ampure XP beads (available from Beckman). Follow manual provided. | ||
Latest revision as of 17:34, 18 November 2011
First Strand Synthesis (modified from Clontech SMARTer Pico cDNA Synthesis Kit)
Starting concentration of total RNA for Clontech SMARTer cDNA Kit 1-20ng/µl
1. Combine the following reagents into separate 0.5 ml reaction tubes for each sample:
3.5 µL total RNA
1 µL modified 3’ SMART CDS Primer II A (12 uM)
4.5 µL total volume
Modified 3’ SMART CDS Primer II A: AAGCAGTGGTATCAACGCAGAGTACTTTTTTCTTTTTT
2. Mix contents and spin tubes briefly in a microcentrifuge
3. Incubate tubes at 72˚C for 3 min, then 42˚C for 2 min
**DO NOT DELAY BETWEEN STEPS 3 and 4!
4. Prepare a master mix for each reaction tube by combining the following reagents:
2 µL 5X 1st strand buffer
0.25 µL DTT (100 mM)
1 µL dNTP mix (10 mM)
1 µL SMARTer II A Oligonucleotide (12 uM)
0.25 µL RNAse inhibitor
1 µL SMARTScribe Reverse Transcriptase (100 U)
5.5 µL total reaction volume
5. Aliquot 5.5 µL of the master mix into each reaction tube. Mix the contents of the tube by gently pipetting and spin tubes briefly to collect contents.
6. Incubate at 42˚C for 90 mins.
7. Terminate the reaction by heating at 72˚C for 10 min.
8. Dilute the final product by adding 30 µL of TE Buffer/dH20 (i.e. total of 40 µL of ss cDNA for each starting RNA extraction).
Second strand synthesis (modified from Clontech Advantage 2 PCR Kit)
1. Aliquot 10 µL of diluted ss cDNA into 4 labeled 0.5 mL reaction tubes.
2. Make a master mix for each reaction +1, using the following:
74 µL Di H20
10 µL 10X Advantage 2 PCR Buffer
2 µL 50X dNTP Mix (10 mM)
2 µL 5’ PCR Primer IIA (12 uM)
2 µL 50X Advantage 2 polymerase Mix
90 µL total reaction volume
3. Mix well by vortexing and briefly spin.
4. Aliquot 90 µL of master mix into each tube from step 2.
5. Commence thermocycling using the following program:
95˚C 1 min
21 – 24 X cycles:
95˚C 15 sec
65˚C 30 sec
68˚C 6 mins
6. Optional: Quantify ds cDNA at different cycles to optimize. I use 21- 24 cycles for most species.
7. Optional: Combine final product into 1 tube.
8. Quantify total ds cDNA using high sensitivity Qubit reagents and/or gel. Typical yields of 2-25 µg total ds cDNA.
9. Purify PCR product using Agencourt Ampure XP beads (available from Beckman). Follow manual provided.