Difference between revisions of "Phylocatenator.pl"

From Ucsbgalaxy
Jump to: navigation, search
(Created page with "What it does This tool written by THO in perl and implemented in Galaxy that produces a concatenated data set for phylogenetics when not all genes are sampled for all species. …")
 
 
(One intermediate revision by the same user not shown)
Line 1: Line 1:
−
What it does
+
==What it does==
  
 
This tool written by THO in perl and implemented in Galaxy that produces a concatenated data set for phylogenetics when not all genes are sampled for all species.
 
This tool written by THO in perl and implemented in Galaxy that produces a concatenated data set for phylogenetics when not all genes are sampled for all species.
  
−
Basic Example
+
==Basic Example==
  
 
The input data must be in column format. Column 1 is species name, C2 is genefamily, C3 individual gene name, C4 is sequence. Sequences of each gene family must be aligned:
 
The input data must be in column format. Column 1 is species name, C2 is genefamily, C3 individual gene name, C4 is sequence. Sequences of each gene family must be aligned:
Line 19: Line 19:
 
Running phylocatenator on the above data with 0 for genes and 0 for species yields:
 
Running phylocatenator on the above data with 0 for genes and 0 for species yields:
  
−
4 32
+
  4 32
−
species1      acgttagcgcgctatagc--gttagtttgcta
+
  species1      acgttagcgcgctatagc--gttagtttgcta
−
species2      acgttag--cgctataaa??????????????
+
  species2      acgttag--cgctataaa??????????????
−
species3      acgttagcgcgctatagcgtgttagtttgcta
+
  species3      acgttagcgcgctatagcgtgttagtttgcta
−
species4      acgttagcgcgctatagc??????????????
+
  species4      acgttagcgcgctatagc??????????????
−
Optional Functionality
+
 
 +
==Optional Functionality==
  
 
I. You may enter a list of species. Species not in this list will not be written to the output file. For example, a species list of:
 
I. You may enter a list of species. Species not in this list will not be written to the output file. For example, a species list of:
  
−
species1
+
  species1
−
species2
+
  species2
 +
 
 
Would change the above output to:
 
Would change the above output to:
  
−
species1      acgttagcgcgctatagc--gttagtttgcta
+
  species1      acgttagcgcgctatagc--gttagtttgcta
−
species2      acgttag--cgctataaa??????????????
+
  species2      acgttag--cgctataaa??????????????
−
Table of partition models
+
 
 +
==Table of partition models==
 
You may enter a table of models for each gene family/partition. Phylocatenator will then sort all the data to put all data for the same models together. It will then create the appropriate partition file, which will specify each model in raxml. Currently, it is only possible to partiion data into valid raxml models.
 
You may enter a table of models for each gene family/partition. Phylocatenator will then sort all the data to put all data for the same models together. It will then create the appropriate partition file, which will specify each model in raxml. Currently, it is only possible to partiion data into valid raxml models.
 +
  
 
The format is a tab-delimited file as follows:
 
The format is a tab-delimited file as follows:
  
−
gene1 WAG
+
  gene1 WAG
−
gene2 JTT
+
  gene2 JTT
−
gene3 DNA
+
  gene3 DNA
−
gene4 WAG
+
  gene4 WAG
 +
 
 
Valid models include the following:
 
Valid models include the following:
  
−
BIN = binary morphological data
+
  BIN = binary morphological data
−
MULTI = multistate morphological data
+
  MULTI = multistate morphological data
−
DNA = DNA data
+
  DNA = DNA data
−
WAG = one of several protein models listed in raxml help documents
+
  WAG = one of several protein models listed in raxml help documents
 +
 
 +
==Known Bugs==
 +
When MULTI data was excluded due to being too small an alignment to make the cut, it still showed up in the partition file, but the ending number was smaller than beginning number

Latest revision as of 23:38, 21 December 2011

What it does[edit]

This tool written by THO in perl and implemented in Galaxy that produces a concatenated data set for phylogenetics when not all genes are sampled for all species.

Basic Example[edit]

The input data must be in column format. Column 1 is species name, C2 is genefamily, C3 individual gene name, C4 is sequence. Sequences of each gene family must be aligned:

 species1      gene1   genenameA       acgttagcgcgctatagc
 species2      gene1   genenameB       acgttag--cgctataaa
 species3      gene1   genenameC       acgttagcgcgctatagc
 species4      gene1   genenameD       acgttagcgcgctatagc
 species1      gene2   genenameE       --gttagtttgcta
 species3      gene2   genenameF       gtgttagtttgcta


Two variables are $gene and $species. These set thresholds for inclusion of data. $species is the minimum number of species that contain a particular gene. $gene sets a minimum number of gene families that a species must have to be included in the dataset.

Running phylocatenator on the above data with 0 for genes and 0 for species yields:

 4 32
 species1      acgttagcgcgctatagc--gttagtttgcta
 species2      acgttag--cgctataaa??????????????
 species3      acgttagcgcgctatagcgtgttagtttgcta
 species4      acgttagcgcgctatagc??????????????

Optional Functionality[edit]

I. You may enter a list of species. Species not in this list will not be written to the output file. For example, a species list of:

 species1
 species2

Would change the above output to:

 species1      acgttagcgcgctatagc--gttagtttgcta
 species2      acgttag--cgctataaa??????????????

Table of partition models[edit]

You may enter a table of models for each gene family/partition. Phylocatenator will then sort all the data to put all data for the same models together. It will then create the appropriate partition file, which will specify each model in raxml. Currently, it is only possible to partiion data into valid raxml models.


The format is a tab-delimited file as follows:

 gene1 WAG
 gene2 JTT
 gene3 DNA
 gene4 WAG

Valid models include the following:

 BIN = binary morphological data
 MULTI = multistate morphological data
 DNA = DNA data
 WAG = one of several protein models listed in raxml help documents

Known Bugs[edit]

When MULTI data was excluded due to being too small an alignment to make the cut, it still showed up in the partition file, but the ending number was smaller than beginning number