Difference between revisions of "Porichthys notatus"
| (5 intermediate revisions by 2 users not shown) | |||
| Line 7: | Line 7: | ||
===History=== | ===History=== | ||
| − | # Prepared cDNA and sent to Duke for 454 sequencing. This was an early 454 run. The first cDNA was not concentrated enough, due to using nanodrop instead of Qbit. 454 run was done on new cDNA Feb 20, 2008. Data for the run is in the phylogeny database. [http:// | + | # Prepared cDNA and sent to Duke for 454 sequencing. This was an early 454 run. The first cDNA was not concentrated enough, due to using nanodrop instead of Qbit. 454 run was done on new cDNA Feb 20, 2008. Data for the run is in the phylogeny database. [http://osiris.eemb.ucsb.edu/phylogeny/454runlist.php ] |
| − | This was our first 454 run, and it is not great. Only 42K reads. Assembly and histograms were done in Newbler 2.6 using Galaxy. The Galaxy History is public [http:// | + | This was our first 454 run, and it is not great. Only 42K reads. Assembly and histograms were done in Newbler 2.6 using Galaxy. The Galaxy History is public [http://galaxy.cnsi.ucsb.edu/root?username=ostratodd&slug=poricthys-photophore] |
# Email 3/4/2009 to Ajna and Sabrina | # Email 3/4/2009 to Ajna and Sabrina | ||
| − | I found a gene that I think is a strong candidate to be the midshipman luciferase. | + | I found a gene that I think is a strong candidate to be the midshipman luciferase. Gene 1029 is a |
| + | "tracheobronchial gastric mucin!!!" we only have a fairly small fragment, but homologs have multiple | ||
| + | Von Willebrand Factor D domains, just like Vargula luciferase!! It is not commonly expressed (only 3 | ||
| + | reads, unless we have other fragments, too). But this is VERY promising to me!! Next step might be | ||
| + | to clone a larger fragment for expression, and to see if this gene catalyzes luciferin. | ||
| − | + | Response: I think RACE is fastest. BTW, there is quite strong blast similarity between Vargula | |
| − | + | luciferin and full length mouse gastric mucin. Some investigation is necessary to see if these large | |
| − | + | proteins can in fact be expressed, or if protein purification directly from the animal is the only | |
| − | + | way to go. | |
| − | |||
| − | |||
| − | |||
| − | Response: I think RACE is fastest. BTW, there is quite strong blast similarity between Vargula luciferin and full length mouse gastric mucin. Some investigation is necessary to see if these large proteins can in fact be expressed, or if protein purification directly from the animal is the only way to go. | ||
# Email of 3/20/2009 to Annie: | # Email of 3/20/2009 to Annie: | ||
Latest revision as of 23:41, 21 September 2013
Identification of Midshipman Luciferase[edit]
Goals[edit]
- Identify midshipman (Porichthys notatus) luciferase
- Express luciferase protein and assay activity
- Identify closely related genes from Porichtys and other fish genomes. Hypothesis: luciferase is derived from digestive enzymes.
History[edit]
- Prepared cDNA and sent to Duke for 454 sequencing. This was an early 454 run. The first cDNA was not concentrated enough, due to using nanodrop instead of Qbit. 454 run was done on new cDNA Feb 20, 2008. Data for the run is in the phylogeny database. [1]
This was our first 454 run, and it is not great. Only 42K reads. Assembly and histograms were done in Newbler 2.6 using Galaxy. The Galaxy History is public [2]
- Email 3/4/2009 to Ajna and Sabrina
I found a gene that I think is a strong candidate to be the midshipman luciferase. Gene 1029 is a "tracheobronchial gastric mucin!!!" we only have a fairly small fragment, but homologs have multiple Von Willebrand Factor D domains, just like Vargula luciferase!! It is not commonly expressed (only 3 reads, unless we have other fragments, too). But this is VERY promising to me!! Next step might be to clone a larger fragment for expression, and to see if this gene catalyzes luciferin.
Response: I think RACE is fastest. BTW, there is quite strong blast similarity between Vargula luciferin and full length mouse gastric mucin. Some investigation is necessary to see if these large proteins can in fact be expressed, or if protein purification directly from the animal is the only way to go.
- Email of 3/20/2009 to Annie:
“The new assembly for midshipman is a bit better, there are 2 contigs that match gastric mucin, perhaps different regions of the gene that didn't quite assemble, c1841 and c753.”
- Email from Steve Haddock re luciferin
I don't have any on hand (I don't think...?) but I might be able to get you a good deal on some luciferin from Prolume.
http://www.nanolight.com/nanofuel.htm
Top Candidate Gene Mucin >midshipT_c1841|mucin-5ac precursor (mucin-5 subtypetracheobronchial) (tracheobronchial mucin)(major airway glycoprotein) (gastric mucin) (lewis b blood group antigen)partial ---OLD assembly gagcccaaccagcatcttagtcaatggtgccccagttattgtgcctttcagtgatgctgtcatttcaattcaaaagaccgtatctcatatcaaaatccaagccccaattggtctggttgttttgtggaatggacaag
>midshipT_c753|mucinsubtypes a andtracheobronchial gastric accaccacacttacaacaccttgcttctgtgactacttgggacaacgatatttgcctggtcaacaaatctatgaacggcgcgatgaggatggctggtgttatactgccgtttgcagttcagaatgtgcagttatcaagaatgatggtccatgtcctactactccaacaaccacaacaactccaacaactccaacaaccattccactaaccacagagaaacaca
