Difference between revisions of "Opsin"
From Ucsbgalaxy
(Created page with "primer info:") |
|||
(One intermediate revision by the same user not shown) | |||
Line 1: | Line 1: | ||
− | primer info: | + | '''general primer info:''' |
+ | |||
+ | Made nested primers for opsin using ''O. bimaculoides'' opsin sequence [http://www.ncbi.nlm.nih.gov/nuccore/AY545172.1] from Genbank. | ||
+ | |||
+ | |||
+ | |||
+ | '''primer sequences:''' | ||
+ | |||
+ | op.fout (forward outer): 5' GCGGCATCAAGAAAATGTCC | ||
+ | |||
+ | op.rout (reverse outer): 5' CCATCATCGCTCTTCTTGCA | ||
+ | |||
+ | length of PCR product: 427 bp | ||
+ | |||
+ | |||
+ | forward inner: 5' TCGGCCCCGTCTTCAACTGG | ||
+ | |||
+ | reverse inner: 5' ccagagcgctgaaatgaaac | ||
+ | |||
+ | |||
+ | |||
+ | '''qPCR primers''' | ||
+ | |||
+ | Also made shorter opsin primers suitable for qPCR using Primer3 website [http://frodo.wi.mit.edu/] |
Latest revision as of 11:32, 2 May 2012
general primer info:
Made nested primers for opsin using O. bimaculoides opsin sequence [1] from Genbank.
primer sequences:
op.fout (forward outer): 5' GCGGCATCAAGAAAATGTCC
op.rout (reverse outer): 5' CCATCATCGCTCTTCTTGCA
length of PCR product: 427 bp
forward inner: 5' TCGGCCCCGTCTTCAACTGG
reverse inner: 5' ccagagcgctgaaatgaaac
qPCR primers
Also made shorter opsin primers suitable for qPCR using Primer3 website [2]