G-q alpha
general primer info:
Made nested primers for G protein alpha q using E. scopoles and O. vulgaris sequences from Genbank
primer sequences:
op.fout (forward outer):
op.rout (reverse outer):
length of PCR product: 630 bp
forward inner:
reverse inner:
qPCR primers
Also made shorter opsin primers suitable for qPCR using Primer3 website [1]
gproaQ forward outer 5' ctwgggactggygagtctgg inner 5' CAGATGAGAATTATCCATGG reverse inner 5' CGTCCATCATGTTTTTAGTM outer 5' cgaatggargartcaaaagc gproaO forward outer 5' CAGGAATTCGGCACAGTAGG inner 5' AAAGAAGATGGTATACAAGC reverse inner 5' cgaactagagttaagacaac outer 5' ggtcaaagatcggaacgtaa gproI forward outer 5' tgtwtacagcaacatwatgc inner 5' gatgaawgtgacatgactcc
reverse inner 5' ggatccactgyttygaaggtg outer 5' gctatwatcttcattgtggc