CDNA Synthesis
First Strand Synthesis (modified from Clontech SMARTer Pico cDNA Synthesis Kit)
Starting concentration of total RNA for Clontech SMARTer cDNA Kit 1-20ng/µl
1. Combine the following reagents into separate 0.5 ml reaction tubes for each sample: 3.5 µL total RNA 1 µL modified 3’ SMART CDS Primer II A (12 uM)* 4.5 µL total volume
2. Mix contents and spin tubes briefly in a microcentrifuge
3. Incubate tubes at 72˚C for 3 min, then 42˚C for 2 min
**DO NOT DELAY BETWEEN STEPS 3 and 4!
4. Prepare a master mix for each reaction tube by combining the following reagents: 2 µL 5X 1st strand buffer 0.25 µL DTT (100 mM) 1 µL dNTP mix (10 mM) 1 µL SMARTer II A Oligonucleotide (12 uM) 0.25 µL RNAse inhibitor 1 µL SMARTScribe Reverse Transcriptase (100 U) 5.5 µL total reaction volume
5. Aliquot 5.5 µL of the master mix into each reaction tube. Mix the contents of the tube by gently pipetting and spin tubes briefly to collect contents.
6. Incubate at 42˚C for 90 mins.
7. Terminate the reaction by heating at 72˚C for 10 min.
8. Dilute the final product by adding 30 µL of TE Buffer/dH20 (i.e. total of 40 µL of ss cDNA for each starting RNA extraction).
- Modified 3’ SMART CDS Primer II A:
AAGCAGTGGTATCAACGCAGAGTACTTTTTTCTTTTTT