Phylocatenator.pl

What it does

This tool written by THO in perl and implemented in Galaxy that produces a concatenated data set for phylogenetics when not all genes are sampled for all species.

Basic Example

The input data must be in column format. Column 1 is species name, C2 is genefamily, C3 individual gene name, C4 is sequence. Sequences of each gene family must be aligned:

 species1      gene1   genenameA       acgttagcgcgctatagc
 species2      gene1   genenameB       acgttag--cgctataaa
 species3      gene1   genenameC       acgttagcgcgctatagc
 species4      gene1   genenameD       acgttagcgcgctatagc
 species1      gene2   genenameE       --gttagtttgcta
 species3      gene2   genenameF       gtgttagtttgcta

Two variables are $gene and $species. These set thresholds for inclusion of data. $species is the minimum number of species that contain a particular gene. $gene sets a minimum number of gene families that a species must have to be included in the dataset.

Running phylocatenator on the above data with 0 for genes and 0 for species yields:

4 32 species1 acgttagcgcgctatagc--gttagtttgcta species2 acgttag--cgctataaa?????????????? species3 acgttagcgcgctatagcgtgttagtttgcta species4 acgttagcgcgctatagc?????????????? Optional Functionality

I. You may enter a list of species. Species not in this list will not be written to the output file. For example, a species list of:

species1 species2 Would change the above output to:

species1 acgttagcgcgctatagc--gttagtttgcta species2 acgttag--cgctataaa?????????????? Table of partition models You may enter a table of models for each gene family/partition. Phylocatenator will then sort all the data to put all data for the same models together. It will then create the appropriate partition file, which will specify each model in raxml. Currently, it is only possible to partiion data into valid raxml models.

The format is a tab-delimited file as follows:

gene1 WAG gene2 JTT gene3 DNA gene4 WAG Valid models include the following:

BIN = binary morphological data MULTI = multistate morphological data DNA = DNA data WAG = one of several protein models listed in raxml help documents