User contributions
From Ucsbgalaxy
- 15:33, 5 July 2017 (diff | hist) . . (+693) . . N Order Primers from Integrated DNA Technology (IDT) (Created page with "== How to order primers from IDT (as of July 5, 2017) == 1) First, you need to log into IDT: username: toakleylab password: morrisaa1 2) Next, download the primer order templa…") (current)
- 12:16, 5 July 2017 (diff | hist) . . (+57) . . Lab Inventory (current)
- 15:34, 29 October 2015 (diff | hist) . . (-1) . . Uploading data (current)
- 15:34, 29 October 2015 (diff | hist) . . (+8) . . Uploading data
- 15:34, 29 October 2015 (diff | hist) . . (+4) . . Oakley-nas1 URL upload (current)
- 15:33, 29 October 2015 (diff | hist) . . (+819) . . N Oakley-nas1 URL upload (Created page with "Use URL links to upload data from oakley-nas1 to Galaxy on knot. 1. Upload your files to IlluminaData by accessing oakley-nas1 through your web browser (https://oakley-nas1.eem…")
- 15:29, 29 October 2015 (diff | hist) . . (+28) . . Uploading data
- 09:57, 19 October 2012 (diff | hist) . . (+66) . . Student Grants Database (→NSF Predoctoral Fellowship)
- 12:46, 30 August 2012 (diff | hist) . . (+1) . . Western Blot (current)
- 12:46, 30 August 2012 (diff | hist) . . (+74) . . N Western Blot (Created page with "From Kathy Foltz [[[Media:BCA Method.doc]]] Media:BCA Assay guide.pdf")
- 12:44, 30 August 2012 (diff | hist) . . (+19) . . Molecular protocols
- 12:17, 25 July 2012 (diff | hist) . . (0) . . Antibody staining
- 12:15, 25 July 2012 (diff | hist) . . (+110) . . Antibody staining
- 12:12, 25 July 2012 (diff | hist) . . (+129) . . Antibody staining
- 11:55, 25 July 2012 (diff | hist) . . (+18) . . Antibody staining
- 11:54, 25 July 2012 (diff | hist) . . (-16) . . Antibody staining
- 11:57, 20 July 2012 (diff | hist) . . (+663) . . N Antibody staining (Created page with "Antibody list ('''updated July 20, 2012''') ''Primary antibodies:'' anti digoxigenin (sheep, monoclonal) anti digoxigenin-AP (sheep, polyclonal) ''Secondary fluorescent ant…")
- 11:32, 2 May 2012 (diff | hist) . . (+98) . . Opsin (current)
- 11:29, 2 May 2012 (diff | hist) . . (-146) . . Phototransduction gene information
- 11:29, 2 May 2012 (diff | hist) . . (+594) . . N Others (Created page with "Arrestin Forward outer 5' TGAAGATATGGAYGTCATGG inner 5' TCCTTYCGAAARGATTTCGC reverse inner 5' GGAATGTACATTAGACAAAG outer 5' GGRTTCCCWATCGAACCAAA PLC Forward outer 5' AYGTAC…") (current)
- 11:29, 2 May 2012 (diff | hist) . . (+594) . . Phototransduction gene information
- 11:08, 2 May 2012 (diff | hist) . . (+389) . . N G-q alpha (Created page with "'''general primer info:''' Made nested primers for G protein alpha q using E. scopoles and O. vulgaris sequences from Genbank '''primer sequences:''' op.fout (forward outer)…")
- 11:01, 2 May 2012 (diff | hist) . . (+413) . . Opsin
- 10:50, 2 May 2012 (diff | hist) . . (+12) . . N Opsin (Created page with "primer info:")
- 10:48, 2 May 2012 (diff | hist) . . (+37) . . N Phototransduction gene information (Created page with "*opsin *G-q alpha *others")
- 10:48, 2 May 2012 (diff | hist) . . (+145) . . N Dispersed photoreception in cephalopod skin (Created page with "*phototransduction gene information *working in-situ hybridization related protocols *Octopus bimaculoides dispersed photoreception") (current)
- 10:44, 2 May 2012 (diff | hist) . . (+51) . . Lab Projects (→Mollusk Projects)
